View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12639_high_3 (Length: 246)
Name: NF12639_high_3
Description: NF12639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12639_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 46800414 - 46800184
Alignment:
| Q |
1 |
ttagagaaatgaaaatcccataaaataagggaagccaaatcaaacgtagggcaccacatacaaccatcaacgagaactaacacacatccatccacccatg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46800414 |
ttagagaaatgaaaatcccgtaaaataagggaagtcaaatcaaacgtggggcgccacatacaaccatcaacgggaactaacacacatccatccacccatg |
46800315 |
T |
 |
| Q |
101 |
agaataattgaatatgcctgtcagggttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaattaatcaaagtaa |
200 |
Q |
| |
|
||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46800314 |
agaataactgaatatgca-gtcagtgttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaattaatcaaagtaa |
46800216 |
T |
 |
| Q |
201 |
tcatttttcttgtaatttacctcatctttttg |
232 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
46800215 |
tcatttttcttgtaatttaccttatctttttg |
46800184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University