View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12639_high_4 (Length: 233)
Name: NF12639_high_4
Description: NF12639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12639_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 217
Target Start/End: Complemental strand, 26203659 - 26203580
Alignment:
| Q |
138 |
atctttgtctatccgaaaaagacacattttctgattagtcgaaaataatatcaaagacaataccttgaatatggtgtaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203659 |
atctttgtctatccgaaaaagacacattttctaatttgtcgatgataatatcaaagacaataccttgaatatggtgtaat |
26203580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 217
Target Start/End: Complemental strand, 26196685 - 26196603
Alignment:
| Q |
135 |
tatatctttgtctatccgaaaaagacacattttctgattagtcgaaaataatatcaaagacaataccttgaatatggtgtaat |
217 |
Q |
| |
|
|||||| |||| |||| |||||| |||| |||||| ||||||| | |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26196685 |
tatatcattgtttatctgaaaaacacacgttttcttattagtcaataataatttccaagacaataccttgaatatggtgtaat |
26196603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University