View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263R-Insertion-7 (Length: 367)
Name: NF1263R-Insertion-7
Description: NF1263R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263R-Insertion-7 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 9 - 359
Target Start/End: Original strand, 13305 - 13655
Alignment:
| Q |
9 |
ccttattcgtgttttgtgaattcagatcctcctttttcctcagttgtgatcgtacgctaccttcataagcgcttttttgtggactttgtttcgaaaaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13305 |
ccttattcgtgttttgtgaattcagatcctcctttttcctcagttgtgattgtacgctaccttcataagcgcttttttgtggacttcgtttcgaaaaaca |
13404 |
T |
 |
| Q |
109 |
cacgaagtttccacttcttgcagcatcttccattgcaggctcttttcctttaccaaacatcttcattgtgctgagatcagattgcaagatatcatagaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13405 |
cacgaagtttccacttcttgcagcatcttccattgcaggctcttttcctttaccaaacatcttcattgtgctgagatcagattgcaagatatcatagaac |
13504 |
T |
 |
| Q |
209 |
tcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaagagatcttggaagtttttggtaccctccagaga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13505 |
tcattgtagaattggtcacttgagtaagcttttgcattgtccatattacaaaggaaattgaaggaaagagatcttggaagtttttggtaccctccagaga |
13604 |
T |
 |
| Q |
309 |
aaaaagacctgaaattttttagccttttgttaaagaaacttttggtcttgt |
359 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13605 |
aaaaagacctgaagttttttagccttttgttaaagaaacttttggtcttgt |
13655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University