View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263R-Insertion-8 (Length: 424)
Name: NF1263R-Insertion-8
Description: NF1263R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263R-Insertion-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 38608822 - 38608607
Alignment:
| Q |
9 |
gaatgtacgttctagtttagttgtacagaagcttaacgagttcatattgatttgttcaattcaggaatctaaaaaggagaagagcagtgactttaaatat |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38608822 |
gaatgtacgttctagttaagttgtacagaagcttaacgagttcatattgatcttttcaattcaggaatctaaaaaggagaagagcagtgactttaaatat |
38608723 |
T |
|
| Q |
109 |
gatgggcctggatggattattcttgctgtagggatagtagcatgtgcgatattattctcaaaattatcggtgaaagacaattcattttaggttgaagttg |
208 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38608722 |
gacgggcctggatggattattcttgcagtagggatagtagcatgtgcgatattattctcaaaattatcagtgaaagacaattcattttaggttgaagttg |
38608623 |
T |
|
| Q |
209 |
tgaaacaaagtattgt |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38608622 |
tgaaacaaagtattgt |
38608607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 279 - 392
Target Start/End: Complemental strand, 38608495 - 38608381
Alignment:
| Q |
279 |
aaatagattcgtgatttacacctttaaaattcactttagaactactcttt-cttaattttctttatctctcattttcaatagatggtgaaaatttcaata |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38608495 |
aaatagattcgtgatttacacctttaaaattcactttagaactactcttttcttaattttctttatctctcattttcaatagatggtgaaaatttcaata |
38608396 |
T |
|
| Q |
378 |
gattattacgtcaca |
392 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38608395 |
gattattacgtcaca |
38608381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 62 - 152
Target Start/End: Complemental strand, 38603625 - 38603535
Alignment:
| Q |
62 |
gttcaattcaggaatctaaaaaggagaagagcagtgactttaaatatgatgggcctggatggattattcttgctgtagggatagtagcatg |
152 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| |||| |||||| || ||||||| ||||||||| | ||| ||||||||||| |
|
|
| T |
38603625 |
gttcatttcaggaatctaaaaagcagaagagcagtgagtttacatatgacttgcttggatgggctattcttgcagcaggtatagtagcatg |
38603535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 264
Target Start/End: Complemental strand, 38608553 - 38608514
Alignment:
| Q |
225 |
aattctcaacctcttgaatcattgttcctaataattgtga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38608553 |
aattctcaacctcttgaatcattgttcctaatagttgtga |
38608514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University