View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_high_9 (Length: 251)
Name: NF1263_high_9
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 41 - 251
Target Start/End: Original strand, 8542945 - 8543156
Alignment:
| Q |
41 |
tctttaaattcaaagaaagaatatattaacaaattatgagtgctaattaatgc-tcagtcttttctggatatattaaccaattatttatggatttcaaca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8542945 |
tctttaaattcaaagaaagaatatattaaccaattatgagtgctaattaatgcctcagtcttttctggatatattaaccaattatttatggatttcaaca |
8543044 |
T |
 |
| Q |
140 |
actactaaaagtgtttagaactctaccaccattgataaaaacactttcaaatgttattgttcaaatataggagcaaacacttctcatctctcatggtaat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8543045 |
actactaaaagtgtttagaactctaccaccattgataaaaacactttcaaatgttattgttcaaatataggagcaaacacatctcatctctcatggtaat |
8543144 |
T |
 |
| Q |
240 |
actacatagtat |
251 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8543145 |
actacatagtat |
8543156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University