View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_15 (Length: 269)
Name: NF1263_low_15
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 34 - 225
Target Start/End: Complemental strand, 43416315 - 43416121
Alignment:
| Q |
34 |
atgttagagtatatttcgtgagcgagta---agaagtgttatatcgttggtgtgacaagtgtgagttagtgaatgttgagcaataactactttaatgttg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
43416315 |
atgttagagtatatttcgtgagcgagtagtaagaagtgttatattgttggtgtgataagtgcgagttagtgaatgttgagcaataactattttgatgttg |
43416216 |
T |
|
| Q |
131 |
tgagtcaacatagtgaaagtgtattttgataaattttcatttgaagaggagaatatagagatgggtggatagactcactcataattcatccccct |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416215 |
tgagtcaacatcgtgaaagtgtattttgataaattttcatttgaaggggagcatatcgagatgggtggatagactcactcataattcatccccct |
43416121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6512 times since January 2019
Visitors: 1241