View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_17 (Length: 268)
Name: NF1263_low_17
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 45088664 - 45088437
Alignment:
| Q |
30 |
ccttaaactgagtgcccttagatctagaatttgcccaatgcgcctgcacttaaactgaatgttgagttccatattcatcatgatgtctacttcttcataa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088664 |
ccttaaactgagtgcccttagatctagaatttgcccaatgcgcctgcacttaaactgaatgttgagttccatattcatcatgatgtctacttcttcataa |
45088565 |
T |
 |
| Q |
130 |
nnnnnnncagccaaagcaattgcttgaagataagcaaggattcaagaatgtggaaatttaataagttggaatttatttgtttttatgtctttgtttgata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088564 |
tttttt-cagccaaagcaattgcttgaagataagcaaggattcaagaatgtggaaatttaataagttggaatttatttgtttttatgtctttgtttgata |
45088466 |
T |
 |
| Q |
230 |
ggttaggttaatttagtatgtttcctttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45088465 |
ggttaggttaatttagtatgtttcctttg |
45088437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University