View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_23 (Length: 251)
Name: NF1263_low_23
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_23 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 8543250 - 8543148
Alignment:
| Q |
149 |
tgagattgagtggtatttggacgaagacaacatgaatgtagatgctaagattaacttgcttgtctagtggaaacaaaatttcttaagatttctaatacta |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8543250 |
tgagattgagtggtatttggatgaagacaacatgaatgtagatgctaagattaacttgcttgtctagtggaaacaaattttcttaagatttctaatacta |
8543151 |
T |
|
| Q |
249 |
tgt |
251 |
Q |
| |
|
||| |
|
|
| T |
8543150 |
tgt |
8543148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 17 - 113
Target Start/End: Complemental strand, 8543385 - 8543286
Alignment:
| Q |
17 |
taggaattaatgatcctcgggggaacctctgtaggaagtaatgtttggttgagcaatagacacaa---ttgcataaatttgattcttttaagagttattt |
113 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
8543385 |
taggaatagatgatcctcgagggaacctctgtaggaagtaatgtttggttgagcaatagacacaatatttgcatcaatttgattcttttaagagttattt |
8543286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 8542457 - 8542494
Alignment:
| Q |
149 |
tgagattgagtggtatttggacgaagacaacatgaatg |
186 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
8542457 |
tgagattgagaggtatttggatgaagacaacatgaatg |
8542494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University