View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_26 (Length: 240)
Name: NF1263_low_26
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 21 - 212
Target Start/End: Original strand, 36605375 - 36605573
Alignment:
| Q |
21 |
cccgccgttatgttttcgtgggaaactgtgcgtgtggacataacccacattccacgtaactcatggataatgcccaaggcccaacccgttttcagttgga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605375 |
cccgccgttatgttttcgtgggaaactgtgcgtgtggacataacccacattccacgtaactcatggataatgcccaaggcccaacccgttttcagttgga |
36605474 |
T |
 |
| Q |
121 |
caaactttcctacctattacta-------acttggaaagtgtatacatcgaagaatatgctttatatagtttggaaatatactttcaaataaatcatct |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||| ||||||||| || ||||||||||||||||| |||| |
|
|
| T |
36605475 |
caaactttcctacctattcctacatgatgacttggaaggtgtatacatcgaagaatatgctttgtatagtttgaaattatactttcaaataaattatct |
36605573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University