View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_28 (Length: 220)
Name: NF1263_low_28
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 39793431 - 39793544
Alignment:
| Q |
107 |
ctctccctgcaacaggtttgtttctactttccnnnnnnnggggactgagcacaacaaaagatcccatcatacgaagtggtaggttgccaagaaaacccta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39793431 |
ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaaccta |
39793530 |
T |
 |
| Q |
207 |
cgtttaccgccgct |
220 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
39793531 |
caattaccgccgct |
39793544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University