View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_30 (Length: 201)
Name: NF1263_low_30
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41703558 - 41703507
Alignment:
| Q |
1 |
cctatgcataattaggattgaagatcaagagtgaagtatacataaagtggtt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41703558 |
cctatgcataattaggattgaagatcaagagtgaagtatacataaagtggtt |
41703507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University