View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1263_low_8 (Length: 293)

Name: NF1263_low_8
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1263_low_8
NF1263_low_8
[»] chr3 (2 HSPs)
chr3 (209-292)||(36882584-36882667)
chr3 (72-128)||(36882737-36882793)
[»] chr6 (1 HSPs)
chr6 (238-290)||(18728385-18728437)
[»] chr1 (1 HSPs)
chr1 (237-290)||(22206498-22206551)


Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 209 - 292
Target Start/End: Complemental strand, 36882667 - 36882584
Alignment:
209 tttatatagctatggatctctcaatcagtgacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgatgt 292  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||    
36882667 tttatagagctatggatctctcaatcagtgacaaatgacatacttgcctaagagctaagtttgctttatcatattgtatgatgt 36882584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 128
Target Start/End: Complemental strand, 36882793 - 36882737
Alignment:
72 atggaaaatctcattaatttctcatgcggcagtgtcaaaacataaataattacgacc 128  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36882793 atggaaaatctcattaatttctcatgcggcagtgtgaaaacataaataattacgacc 36882737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 290
Target Start/End: Original strand, 18728385 - 18728437
Alignment:
238 gacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgat 290  Q
    |||||||| ||||||||||||||||||| |||||||| || ||||||||||||    
18728385 gacaaatgtcatacttgccaaagaactatgtttgctttattatattgtatgat 18728437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 290
Target Start/End: Original strand, 22206498 - 22206551
Alignment:
237 tgacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgat 290  Q
    ||||||||| |  ||||||||||||||||| ||||||| || ||||||||||||    
22206498 tgacaaatgtctaacttgccaaagaactaactttgctttattatattgtatgat 22206551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University