View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263_low_8 (Length: 293)
Name: NF1263_low_8
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 209 - 292
Target Start/End: Complemental strand, 36882667 - 36882584
Alignment:
| Q |
209 |
tttatatagctatggatctctcaatcagtgacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgatgt |
292 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
36882667 |
tttatagagctatggatctctcaatcagtgacaaatgacatacttgcctaagagctaagtttgctttatcatattgtatgatgt |
36882584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 128
Target Start/End: Complemental strand, 36882793 - 36882737
Alignment:
| Q |
72 |
atggaaaatctcattaatttctcatgcggcagtgtcaaaacataaataattacgacc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36882793 |
atggaaaatctcattaatttctcatgcggcagtgtgaaaacataaataattacgacc |
36882737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 290
Target Start/End: Original strand, 18728385 - 18728437
Alignment:
| Q |
238 |
gacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgat |
290 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
18728385 |
gacaaatgtcatacttgccaaagaactatgtttgctttattatattgtatgat |
18728437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 290
Target Start/End: Original strand, 22206498 - 22206551
Alignment:
| Q |
237 |
tgacaaatgacatacttgccaaagaactaagtttgcttcatcatattgtatgat |
290 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
22206498 |
tgacaaatgtctaacttgccaaagaactaactttgctttattatattgtatgat |
22206551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University