View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12640_low_11 (Length: 310)
Name: NF12640_low_11
Description: NF12640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12640_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 4 - 298
Target Start/End: Complemental strand, 29705048 - 29704754
Alignment:
| Q |
4 |
tggacatcatcattattaatcatgtttgttttttcttctaacttcttcctcaccaacttcttgagaacccgcaaactagcagtcttaacatcgatggttt |
103 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29705048 |
tggacatcatcattattaaccatgtttgttttttcttctaacttcttcctcaccaacttcttgagaacccgcaaactagcagtcttaacattgatggttt |
29704949 |
T |
 |
| Q |
104 |
tcgagttttctttcatcacagtaggattgccagtaccacactcaatctccttgatttctgactgagctgagcaaacgggttctccctttatcttctcaga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29704948 |
tcgagttttctttcatcacagtaggattgccagtaccacactcaatctccttgatttctgaatgagctgagcaaacgggttccccctttatcttctcaga |
29704849 |
T |
 |
| Q |
204 |
aaccacaaactcagtgtagtcctctgctgcatgttccttggtttgtgcttcagcttcctgtttctcagaagtatccttctgaccttctactttct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29704848 |
aaccacaaactcagtgtagtcctctgctgcatgttcctcggtttgtgcttcagcttcctgtttctcagaagtatccttctgatcttctactttct |
29704754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University