View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12640_low_14 (Length: 256)
Name: NF12640_low_14
Description: NF12640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12640_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 37054490 - 37054738
Alignment:
| Q |
1 |
tgaaagctttcatcttctgatgaatcacaatcttcatgaacaattttatcaacacattcatgttcatttttta---ctagtttttcttcatgaacagaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
37054490 |
tgaaagctttcatcttctgatgaatcacaatcttcatgaacaattttatcaacacattcatgttcattttttattactagttcttcttcatgaacagaaa |
37054589 |
T |
 |
| Q |
98 |
caatttccttagtaaaagaactactaacattattgtcactagtctttgtcaaagtacaagcatgttgttcaacatcttcacctaatgcatcaagatagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054590 |
caatttccttagtaaaagaactactaacattattgtcactagtctttgtcaaagtacaagcatgttgttcaacatcttcacctaatgcatcaagatagaa |
37054689 |
T |
 |
| Q |
198 |
cagatctagtcctggatttaaactcaccttgccttttgtttttcctttg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054690 |
cagatctagtcctggatttaaactcaccttgccttttgtttttcctttg |
37054738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University