View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12642_low_12 (Length: 286)
Name: NF12642_low_12
Description: NF12642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12642_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 23 - 270
Target Start/End: Original strand, 2350657 - 2350891
Alignment:
| Q |
23 |
aaatcgaccttatccttttgggtggagtttgtgccagaaaattcatcatttgctgtaattaaaatggtatacgcattatgcaggtttgacatatctatca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| ||||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2350657 |
aaatcgaccttatccttttgggtggagtatgtgttagaaaattcgtcatttgctataattaaaatggtaca-------tgcaggtttgacatatctatca |
2350749 |
T |
 |
| Q |
123 |
tgaagccaatttatctccaaccctctttcnnnnnnnnccctctttaatnnnnnnntgtgtagttactagtttgnnnnnnnnnnnaatcttgtaaaaataa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| ||| || |
|
|
| T |
2350750 |
tgaagccaatttatctccaaccctctttcaaaaaaaaccctctttaataaaaaattgtgtagttactagttt--ttttttttttaatctt----aaaaaa |
2350843 |
T |
 |
| Q |
223 |
actagtttctttttaaatgtattaattaactcaagtagaaaatctcaa |
270 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2350844 |
actagtctctttttaaatgtattaattaactcaactagaaaatctcaa |
2350891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University