View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12642_low_14 (Length: 264)
Name: NF12642_low_14
Description: NF12642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12642_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 24014186 - 24013939
Alignment:
| Q |
11 |
cagagaggaaagaaggacgattgcacctgagcatgtattgaaagctttaggggtattcatctaatgaccaaaccatttaatctccaaattttgatgtgga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24014186 |
cagagaggaaagaaggacgattgcacctgagcatgtattgaaagctttaggggtattcatctaatgaacaaaccatttaatctccaaattttgatgtgga |
24014087 |
T |
 |
| Q |
111 |
tccttttcaattttaatttgattgcttatattatacgccctcttcttggacgttctgtgcattgatttgtatctttctcatgtggatccttttcaatggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24014086 |
tccttttcaattttaatttgattgcttatataatacgctctcttcttggacgttctgtgcattgatttgtatctttctcatgtggatccttttcaatggt |
24013987 |
T |
 |
| Q |
211 |
gttattcttgatttttctttgcattgtagttgggtttgatgtccatct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24013986 |
gttattcttgatttttctttgcattgtagttgggtttgatggccatct |
24013939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University