View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12645_high_2 (Length: 288)
Name: NF12645_high_2
Description: NF12645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12645_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 21 - 269
Target Start/End: Original strand, 32511034 - 32511283
Alignment:
| Q |
21 |
gagaaagcctgtgatacatttaccaatgacactttgcagaaaccttccaatgctggtcacgaaaatcaagattgaccaaaaacctccctctttcttccct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32511034 |
gagaaagcctgtgatacatttaccaatgacactttgcagaaaccttccaatgctggtcacgaaaatcaagattgaccaaaaacctccctctttcttccct |
32511133 |
T |
 |
| Q |
121 |
catatgcaccaattgcatcaaaatggtttcacaaaatg-annnnnnnncagcacacacacnnnnnnnnnccaagataaacaaacccttttaagatcagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
32511134 |
catatgcaccaattgcatcaaaatggtttcacaaaatgaattttttttcagcacacacacaaaaaaaaaccaaaataaacaaacccttttaagatcagaa |
32511233 |
T |
 |
| Q |
220 |
acaattgttgaagttgaaatatgaaaatgcttcctaaaaggtggtggtgc |
269 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32511234 |
acaattgttgaagttgaaatacgaaaatgcttcctaaaaggtggtggtgc |
32511283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University