View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12646_high_5 (Length: 269)
Name: NF12646_high_5
Description: NF12646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12646_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 48802314 - 48802073
Alignment:
| Q |
18 |
cagtccggatcctacaagtcattttgtaggattttgtcacaatcaatgtcagaattctaagatttgaagttctgatgaccttagaggttgcatgcaatag |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48802314 |
cagtccggatccaacaagtcattttgtaggattttgtcacactcaatgtcagaattctaagatttgaagttctgatgaccttagaggttgcatgcaatag |
48802215 |
T |
|
| Q |
118 |
tgagctatgtaccactaatacgatgtgtcgagtgtccaatacttgtcggtctttgacactaacacgacatgcatgtggatacactcaatcacttcaattt |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48802214 |
tgagctatgaaccactaatacgatgtgtcgagtgtccaatacgtgtcggtctttgacactgacacgacatgcatgtggatacactcaatcacttcaattt |
48802115 |
T |
|
| Q |
218 |
tctcaaattatcaacttcagtgtcatgtttgttgcacctatg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48802114 |
tctcaaattatcaacttcagtgtcatgtttgttgcatctatg |
48802073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University