View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12646_low_6 (Length: 229)
Name: NF12646_low_6
Description: NF12646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12646_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 93 - 215
Target Start/End: Complemental strand, 6852991 - 6852869
Alignment:
| Q |
93 |
gaatctaaccaagcacaagatatctaacaacattaagggtctgattaggaggagttttggagggctaagtctatattttgatattttagaaaaagtttaa |
192 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6852991 |
gaatctaaccaaacacaagatatctaacaacattaagggtctgattcggaggagttttggagcgctaagtctatattttgatattttagaaaaagtttaa |
6852892 |
T |
 |
| Q |
193 |
atatgattttagtccatgttagt |
215 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
6852891 |
atatgattttagtccctgttagt |
6852869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 178
Target Start/End: Complemental strand, 37152077 - 37152046
Alignment:
| Q |
147 |
ttttggagggctaagtctatattttgatattt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37152077 |
ttttggagggctaagtctatattttgatattt |
37152046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 176
Target Start/End: Original strand, 44114117 - 44114145
Alignment:
| Q |
148 |
tttggagggctaagtctatattttgatat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44114117 |
tttggagggctaagtctatattttgatat |
44114145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 176
Target Start/End: Original strand, 24277996 - 24278026
Alignment:
| Q |
146 |
gttttggagggctaagtctatattttgatat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24277996 |
gttttggagggctaagtctatattttgatat |
24278026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 146 - 179
Target Start/End: Original strand, 26178402 - 26178435
Alignment:
| Q |
146 |
gttttggagggctaagtctatattttgatatttt |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
26178402 |
gttttggagggctaagtttatattttgatatttt |
26178435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 146 - 179
Target Start/End: Original strand, 19177172 - 19177205
Alignment:
| Q |
146 |
gttttggagggctaagtctatattttgatatttt |
179 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
19177172 |
gttttggagggctaagtctatatgttgatatttt |
19177205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 176
Target Start/End: Original strand, 50016964 - 50016992
Alignment:
| Q |
148 |
tttggagggctaagtctatattttgatat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50016964 |
tttggagggctaagtctatattttgatat |
50016992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University