View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12647_high_4 (Length: 361)

Name: NF12647_high_4
Description: NF12647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12647_high_4
NF12647_high_4
[»] chr6 (1 HSPs)
chr6 (20-353)||(32822762-32823092)
[»] chr1 (1 HSPs)
chr1 (246-353)||(52721673-52721780)


Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 20 - 353
Target Start/End: Original strand, 32822762 - 32823092
Alignment:
20 ggaagaactcaaatctgctttgttgaaaaatcctaacttcttagggtttggaattccaaagattgagatcattgacgaaactattttgctcaatagcttt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32822762 ggaagaactcaaatctgctttgttgaaaaatcctaacttcttagggtttggaattccaaagattgagatcattgacgaaactattttgctcgatagcttt 32822861  T
120 cccgtgaaccgaaaacaatcaaatagaagggcttccaagaagattcacaagaacacccttcctttagctgtcactgaggagcttgttgcagccgcaaaca 219  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||    
32822862 cctgtgaaccgaaaacaatcaaatagaagggcttccaagaagattcacaagaacacccttcctttaactgtcactgaggagcttgttgcagcggaaaaca 32822961  T
220 gcgatgagagtgagagggagaacaagaagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaa 319  Q
    |||||||||||||||||| |   |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32822962 gcgatgagagtgagaggggg---aagaagaagaagtactctcgagaggtgatggaagctacgaggtttgtgaatgtccccgagcagtgcaaattctggaa 32823058  T
320 tagaatctacgccgcacttcaatcttcctttgct 353  Q
    ||||||||||||||||||||||||||||||||||    
32823059 tagaatctacgccgcacttcaatcttcctttgct 32823092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 246 - 353
Target Start/End: Original strand, 52721673 - 52721780
Alignment:
246 aagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatctt 345  Q
    |||||||||||||||||||||||||||||  ||| |||||||||||||||| |  |||||  ||| |||||||| | ||||||| |||| |||||||||     
52721673 aagaagaagtactctcgagagatgatggagtctatgaggtttgtgaatgtctctcagcagctcaaattctggaaaacaatctacaccgcgcttcaatctg 52721772  T
346 cctttgct 353  Q
    | ||||||    
52721773 cttttgct 52721780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University