View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12647_low_4 (Length: 361)
Name: NF12647_low_4
Description: NF12647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12647_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 20 - 353
Target Start/End: Original strand, 32822762 - 32823092
Alignment:
| Q |
20 |
ggaagaactcaaatctgctttgttgaaaaatcctaacttcttagggtttggaattccaaagattgagatcattgacgaaactattttgctcaatagcttt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32822762 |
ggaagaactcaaatctgctttgttgaaaaatcctaacttcttagggtttggaattccaaagattgagatcattgacgaaactattttgctcgatagcttt |
32822861 |
T |
 |
| Q |
120 |
cccgtgaaccgaaaacaatcaaatagaagggcttccaagaagattcacaagaacacccttcctttagctgtcactgaggagcttgttgcagccgcaaaca |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||| |
|
|
| T |
32822862 |
cctgtgaaccgaaaacaatcaaatagaagggcttccaagaagattcacaagaacacccttcctttaactgtcactgaggagcttgttgcagcggaaaaca |
32822961 |
T |
 |
| Q |
220 |
gcgatgagagtgagagggagaacaagaagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaa |
319 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32822962 |
gcgatgagagtgagaggggg---aagaagaagaagtactctcgagaggtgatggaagctacgaggtttgtgaatgtccccgagcagtgcaaattctggaa |
32823058 |
T |
 |
| Q |
320 |
tagaatctacgccgcacttcaatcttcctttgct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32823059 |
tagaatctacgccgcacttcaatcttcctttgct |
32823092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 246 - 353
Target Start/End: Original strand, 52721673 - 52721780
Alignment:
| Q |
246 |
aagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatctt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| | ||||| ||| |||||||| | ||||||| |||| ||||||||| |
|
|
| T |
52721673 |
aagaagaagtactctcgagagatgatggagtctatgaggtttgtgaatgtctctcagcagctcaaattctggaaaacaatctacaccgcgcttcaatctg |
52721772 |
T |
 |
| Q |
346 |
cctttgct |
353 |
Q |
| |
|
| |||||| |
|
|
| T |
52721773 |
cttttgct |
52721780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University