View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_1D_low_15 (Length: 246)
Name: NF1264_1D_low_15
Description: NF1264_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_1D_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 33121149 - 33121371
Alignment:
| Q |
1 |
gcttggcggattctattaaaagtagagatttaatattgaaaatagcaatttttaaacttataaacatttgaatatatgattcttgagacaaaattactat |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33121149 |
gcttggcggtttctattaaaagtagagatttaatattgaaaatagcaatttttaaacttctaaacatttgaatatatgattcttgagacaaaattactat |
33121248 |
T |
 |
| Q |
101 |
atatagttactttcatatttctttttagaattgtatctccccaacattttcataagcgatacggtttggtttggattgcttgtgagacaaaaaatcattc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33121249 |
atatagtta-----------ctttttagaattgtatctccccaatattttcataaacgatacggtttggtttggattggttgtgagacaaaaaatcattc |
33121337 |
T |
 |
| Q |
201 |
aaacaaaaaatttaaaggcctgtgcttcggttca |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
33121338 |
aaacaaaaaatttaaaggattgtgcttcggttca |
33121371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University