View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_1D_low_20 (Length: 229)
Name: NF1264_1D_low_20
Description: NF1264_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_1D_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 38223635 - 38223845
Alignment:
| Q |
19 |
aatcttccatgcacataagcatgaaactcgtcattgtcaaactcgtagccaagggcctgatagtcggaaattaagactaaaacttagaaaaactattaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223635 |
aatcttccatgcacataagcatgaaaatcatcattgtcaaactcgtagccaagggcctgatagtaggaaattaagactaaaacttagaaaaactattaaa |
38223734 |
T |
|
| Q |
119 |
ttatatcactgatcatttatattgaattagtatttcagaagaaattaagagaagagaaaactgaggttaatgccaaatctgtataccttcattcctgcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223735 |
ttatatcactgatcatttatattgaattagtatttcagaagaaattaagagaagagaaaactgaggttaatgccaaatctgtataccttcattcctgcca |
38223834 |
T |
|
| Q |
219 |
tagttgtcccg |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
38223835 |
tagttgtcccg |
38223845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University