View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_1D_low_24 (Length: 208)
Name: NF1264_1D_low_24
Description: NF1264_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_1D_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 7534624 - 7534768
Alignment:
| Q |
7 |
agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcattttgagtatgccaacgatgttacctactcctgctttttcaaattgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7534624 |
agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcattttgagtatgccaacgatgttacctactcctgctttttcaaattgtt |
7534723 |
T |
 |
| Q |
107 |
cactccaaatcagttaattaatacttctctaatttacaacggaaa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7534724 |
cactccaaatcagttaattaatacttctctaatttacaacggaaa |
7534768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 46965119 - 46965171
Alignment:
| Q |
7 |
agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcat |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46965119 |
agttgacgaattgcgatgcgaagttcgcttctgcaactttctttcgaactcat |
46965171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University