View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1264_1D_low_24 (Length: 208)

Name: NF1264_1D_low_24
Description: NF1264_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1264_1D_low_24
NF1264_1D_low_24
[»] chr8 (1 HSPs)
chr8 (7-151)||(7534624-7534768)
[»] chr1 (1 HSPs)
chr1 (7-59)||(46965119-46965171)


Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 7534624 - 7534768
Alignment:
7 agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcattttgagtatgccaacgatgttacctactcctgctttttcaaattgtt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7534624 agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcattttgagtatgccaacgatgttacctactcctgctttttcaaattgtt 7534723  T
107 cactccaaatcagttaattaatacttctctaatttacaacggaaa 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
7534724 cactccaaatcagttaattaatacttctctaatttacaacggaaa 7534768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 46965119 - 46965171
Alignment:
7 agttgacgaattgcgatgcgaagttcgcttctgcaactttcttttgaactcat 59  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
46965119 agttgacgaattgcgatgcgaagttcgcttctgcaactttctttcgaactcat 46965171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University