View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_1D_low_25 (Length: 201)
Name: NF1264_1D_low_25
Description: NF1264_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_1D_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 51 - 183
Target Start/End: Complemental strand, 25707636 - 25707502
Alignment:
| Q |
51 |
gtattacactatgtgcatgtttggaactaggatgtctagtttttgtctccgaatgtgatttttacattgatgtttgtttggtt--gtttctatacagata |
148 |
Q |
| |
|
|||| |||||||||||||||||| || | |||||||||||||||||||||||||||||| | |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25707636 |
gtatcacactatgtgcatgtttgaaatcaagatgtctagtttttgtctccgaatgtgattctgacatcgatgtttgtttggttttgtttctatacagata |
25707537 |
T |
 |
| Q |
149 |
cgagtattgttcctcctcttatctatgctgtgatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25707536 |
cgagtattgttcctcctcttatctatgctgtgatg |
25707502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University