View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_2D_high_21 (Length: 237)
Name: NF1264_2D_high_21
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_2D_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 29665564 - 29665363
Alignment:
| Q |
19 |
gtgttgttggctggtttttaccatgttggcgttgagtcaacaaaggtatagggtggtggatatttgattccgtgtacagcttttgttgcaacatagactt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29665564 |
gtgttgttggctggtttttaccatgttggcgttgagtcaacaaaggtatagggtggtggatatttgattccgtgtacagcttttgttgcaacaaagactt |
29665465 |
T |
 |
| Q |
119 |
atacagacataaaattggacgcatcttatggtccaatttaatttgcttcacaataatgatactagtagacgcaatttaagaaaaagagaggaccctactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| || ||| |
|
|
| T |
29665464 |
atacagacataaaattggacgcatcttatggtccaatttaatttgcttcatcataatgatactagtatacgcaatttaagaaaaagagaggacgctgctt |
29665365 |
T |
 |
| Q |
219 |
gg |
220 |
Q |
| |
|
|| |
|
|
| T |
29665364 |
gg |
29665363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 115 - 194
Target Start/End: Original strand, 29677886 - 29677965
Alignment:
| Q |
115 |
acttatacagacataaaattggacgcatcttatggtccaatttaatttgcttcacaataatgatactagtagacgcaatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
29677886 |
acttatacagacataaaattggacgcatcttatgatccaatttaatttgattcatcataataatactagtagacgcaatt |
29677965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University