View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_2D_high_23 (Length: 230)
Name: NF1264_2D_high_23
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_2D_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 213
Target Start/End: Complemental strand, 34429779 - 34429576
Alignment:
| Q |
7 |
tcaatttcaacaacttcaccaaattctcatcagaagcatcatctcttgctgctaacacagcctcctccaacactttgcattcattttcccaaccattctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34429779 |
tcaatttcaacaacttcaccaaattctcatcagaagcatcatctcttgctgctaacacagcctcctccaacacttcgcattcattttcccaaccattctt |
34429680 |
T |
|
| Q |
107 |
cttttcctgttgctttgcattctcaacacccataccatcctcctcatcatcatcatcgtcgccttctttgtattccgattttatacgtttacttctacta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429679 |
cttttcctgttgctttgcattctcaacacccataccatccccctcatcatcatcatcgt---cttctttgtattccgattttatacgtttacttctacta |
34429583 |
T |
|
| Q |
207 |
cttctac |
213 |
Q |
| |
|
||||||| |
|
|
| T |
34429582 |
cttctac |
34429576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University