View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1264_2D_high_9 (Length: 360)

Name: NF1264_2D_high_9
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1264_2D_high_9
NF1264_2D_high_9
[»] scaffold0707 (1 HSPs)
scaffold0707 (22-73)||(6058-6109)
[»] chr6 (1 HSPs)
chr6 (22-73)||(33576850-33576901)


Alignment Details
Target: scaffold0707 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0707
Description:

Target: scaffold0707; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 6109 - 6058
Alignment:
22 tattcctgctcacatccatctgttaatgaaattatgtttaacactgccactt 73  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||    
6109 tattcttgctcacatccatttgttaatgaaattatgtttaacactgccactt 6058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 33576901 - 33576850
Alignment:
22 tattcctgctcacatccatctgttaatgaaattatgtttaacactgccactt 73  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||    
33576901 tattcttgctcacatccatttgttaatgaaattatgtttaacactgccactt 33576850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University