View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_2D_low_19 (Length: 360)
Name: NF1264_2D_low_19
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_2D_low_19 |
 | |
|
| [»] scaffold0707 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0707 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 6109 - 6058
Alignment:
| Q |
22 |
tattcctgctcacatccatctgttaatgaaattatgtttaacactgccactt |
73 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6109 |
tattcttgctcacatccatttgttaatgaaattatgtttaacactgccactt |
6058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 33576901 - 33576850
Alignment:
| Q |
22 |
tattcctgctcacatccatctgttaatgaaattatgtttaacactgccactt |
73 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33576901 |
tattcttgctcacatccatttgttaatgaaattatgtttaacactgccactt |
33576850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University