View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264_2D_low_58 (Length: 208)
Name: NF1264_2D_low_58
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264_2D_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 39959940 - 39960131
Alignment:
| Q |
1 |
aatttatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgtgatcatggctgcatcattcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39959940 |
aatttatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgtgatcatggctgcatcattcatg |
39960039 |
T |
 |
| Q |
101 |
catgctactttcgatcgtctgccactggaagacgatgaacttgctgctgcaatgcagaatcagcattaccaaaatggacgcgcggcacaaca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39960040 |
catgctactttcgatcgtctgccactggaagacgatgaacttgctgctgcaatgcagaatcagcattaccaaaatggacgcgcggcacaaca |
39960131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 3332108 - 3332035
Alignment:
| Q |
5 |
tatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgt |
78 |
Q |
| |
|
||||||||||| | ||||| || |||||||| || ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
3332108 |
tatttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacctgttgt |
3332035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University