View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265-Insertion-2 (Length: 216)
Name: NF1265-Insertion-2
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265-Insertion-2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 216
Target Start/End: Complemental strand, 40655502 - 40655294
Alignment:
| Q |
8 |
ggttagacagctataaatgtgagtcacgcaaacatctctgcccgagtttaaatcgagtattttttgtttgatgagttattaaatcttctttacagaatag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40655502 |
ggttagacagctataaatgtgagtcacgcaaacatctctgcccgagtttaaatcgagtattttttgtttgatgagttattaaatcttctttacagaatag |
40655403 |
T |
|
| Q |
108 |
gagtttcttattatgattccagccttcgacaacttaatgtgcttgaagcttgggatgatggggacaatggtttttcagttattgatctcggtatgctttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40655402 |
gagtttcttattatgattccagccttcgacaacttaatgtgcttgaagcttgggatgatggggacaatggtttttcagttattgatctcggtatgctttt |
40655303 |
T |
|
| Q |
208 |
cccccctca |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
40655302 |
cccccctca |
40655294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University