View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12650_low_12 (Length: 242)
Name: NF12650_low_12
Description: NF12650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12650_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 17658618 - 17658838
Alignment:
| Q |
19 |
gcttgctctatgcgtcttgtgcagatgtagcggttaataaattttggttgtttnnnnnnnng--ctataacaggaaattgaattgatcttattggaattt |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
17658618 |
gcttgctctgtgcgtcttgtgcagatgtagcggttaataaattttggttgtttcaaaaaaaaaactataacaggaaattggattgatcttgttggaattt |
17658717 |
T |
 |
| Q |
117 |
taggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaaaaggttagagatcggaattatgtacaccggatccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17658718 |
taggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaa |
17658817 |
T |
 |
| Q |
217 |
tagccttcacaggttctgctc |
237 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
17658818 |
tagccttcacaggttgtgctc |
17658838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University