View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12650_low_12 (Length: 242)

Name: NF12650_low_12
Description: NF12650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12650_low_12
NF12650_low_12
[»] chr4 (1 HSPs)
chr4 (19-237)||(17658618-17658838)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 17658618 - 17658838
Alignment:
19 gcttgctctatgcgtcttgtgcagatgtagcggttaataaattttggttgtttnnnnnnnng--ctataacaggaaattgaattgatcttattggaattt 116  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||| ||||||||| |||||||||    
17658618 gcttgctctgtgcgtcttgtgcagatgtagcggttaataaattttggttgtttcaaaaaaaaaactataacaggaaattggattgatcttgttggaattt 17658717  T
117 taggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaaaaggttagagatcggaattatgtacaccggatccaa 216  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||    
17658718 taggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaa 17658817  T
217 tagccttcacaggttctgctc 237  Q
    ||||||||||||||| |||||    
17658818 tagccttcacaggttgtgctc 17658838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University