View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12650_low_7 (Length: 344)
Name: NF12650_low_7
Description: NF12650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12650_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 13 - 328
Target Start/End: Complemental strand, 45164996 - 45164681
Alignment:
| Q |
13 |
taggatttttatgatattctgatgccgaatcttgctcaacaaactcacttcattctgcaaattcagtgtaataactaaaggcaaattcagtatgcaagga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164996 |
taggatttttatgatattctgatgccgaatcttgctcaacaaactcacttcattctgcaaattcagtgtaataactaaaggcaaattcagtatgcaagga |
45164897 |
T |
|
| Q |
113 |
aatagtacacattgaaatcttattgtaaaggatcatcacctcaaattctctatcagcattactgtctgctttcttgacagcagcctggaaatgttcatca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164896 |
aatagtacacattgaaatcttattgtaaaggatcatcacctcaaattctctatcagcattactgtctgctttcttgacagcagcctggaaatgttcatcg |
45164797 |
T |
|
| Q |
213 |
aaacgagctctgtaaacaattatagaaccagtctctcccatgatattatcttcggaaaagctgtttgttgcagactctaacaactgaaagtcgaaaatag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164796 |
aaacgagctctgtaaacaattatagaaccagtctctcccatgatattatcttgggaaaagctgtttgttgcagactctaacaactgaaagtcgaaaatag |
45164697 |
T |
|
| Q |
313 |
caattgaactcttctt |
328 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45164696 |
caattgaactcttctt |
45164681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University