View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12651_high_11 (Length: 236)
Name: NF12651_high_11
Description: NF12651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12651_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 18100340 - 18100134
Alignment:
| Q |
12 |
aacctgtgtctgttcaaaagatattgccaatgagaagaggaaagattttcctgccaagtcaaagaaaatacaagacaacggacattaccccgaaaataca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100340 |
aacctgtgtctgttcaaaagatattgccaatgagaagaggaaagattttcctgccaagtcaaagaaaatacaagacaacggacattaccccgaaaataca |
18100241 |
T |
 |
| Q |
112 |
tattgctaaagatttccaggtgatgaggctgtagtagtcaacaaacggcatcaactgtatgtctccatacgtttgtgcttctttccacagttcttcatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100240 |
tattgctaaagatttccaggtgatgaggctgtagtagtcaacaaacggcatcaactgtatgtctccatacgtttgtgcttctttccacagttcttcatta |
18100141 |
T |
 |
| Q |
212 |
actattt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
18100140 |
actattt |
18100134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University