View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12651_low_27 (Length: 206)
Name: NF12651_low_27
Description: NF12651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12651_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 19074678 - 19074497
Alignment:
| Q |
9 |
gtgagaagaatgggaacaaggaggaaaaatgggagttttgcccttttatagtcttaagtgtaaaattactaaattccccttttgctaaatttctctgata |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074678 |
gtgagaagaatgggaacaatgaggaaaaatgggagttttgcccttttatagtctcaagtgtaaaattactaaattccccttttgctaaatttctctgata |
19074579 |
T |
|
| Q |
109 |
cgcttaaacggataccgcattcttataggaattaagcgggatattacnnnnnnntcatcatttgattatttcaagttgatgt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
19074578 |
cgcttaaacggataccgcattcttatagtaatttagcgggatattacaaaaaaatcatcatttgattatttcaagttcatgt |
19074497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University