View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12656_high_3 (Length: 385)
Name: NF12656_high_3
Description: NF12656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12656_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 2 - 370
Target Start/End: Original strand, 34884652 - 34885018
Alignment:
| Q |
2 |
gctgtcatcttctctcgtgttgtgttcgtgtatcagggaaaannnnnnnnnnnnagtgctcaatttcataatcccgcgcgataatcaaaggttagctttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34884652 |
gctgtcatcttctctcgtgttgtgttcgtgtatcagggaaaactctctctct--agtgctcaatttcataatcccgcgcgataatcaaaggttagcttcc |
34884749 |
T |
|
| Q |
102 |
atcaatcacactttcacgtaactttctcattaattaatctaattagcacttgttaataatcaaccaggtttcaaatcatgaacgggtctccggatccacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34884750 |
atcaatcacactttcacgtaactttctcattaattaatctaattagcacttgttaataatcaaccaggtttcaaatcatgaacgggtctccggatccacc |
34884849 |
T |
|
| Q |
202 |
gttggattcatttccccggttacgtctccaccaatcagacggtctatctcgccgttcttccttcggcgccgaatcggattctgaacgttactgcagcgcc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34884850 |
gttggattcatttccccggttacgtctccaccaatcagacggtctatctcgccgctcttccttcggcgccgaatcggattctgaacgttactgcagcgcc |
34884949 |
T |
|
| Q |
302 |
agtaactcaatgatgggaacaccgaacaccagcatgagcatccgaagtgccgttaccgtcttccacgat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34884950 |
agtaactcaatgatgggaacaccgaacaccagcatgagcatccgaagtgccgttaccgtcttccacgat |
34885018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University