View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12657_high_4 (Length: 422)
Name: NF12657_high_4
Description: NF12657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12657_high_4 |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 145 - 388
Target Start/End: Complemental strand, 5385939 - 5385695
Alignment:
| Q |
145 |
tcaccgttaagatggagactttgtatgatatttaatcaaggaaattacggtggatataataacaaagctggcatgaatgagcaatccattggagcaaacg |
244 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5385939 |
tcaccattaagatggagactttgtatgatatttaatcaaggaaattacggttgatataataacaaagctggcacgaatgagcaatccattggagcaaacg |
5385840 |
T |
 |
| Q |
245 |
gtggataacgcacatatcatc-tccattgcactgaaaacaacaaacaatattcgcacgtcaatattgaagaaagccaatcagtctataaaaagttaaaaa |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
5385839 |
gtggataacgcacatatcatcctccattgcactgaaaacaacaaacaatattcgcacgtcaatattgaagaaagccaatcagtctataacaagctaaaaa |
5385740 |
T |
 |
| Q |
344 |
gaaatcaactgaacataaatatgccaacacagaaccataaaataa |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5385739 |
gaaatcaactgaacataaatatgccaacacagaaccataaaataa |
5385695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 2132 - 2083
Alignment:
| Q |
17 |
gttttccactgagtttgctgcagaggcacagatgcataggaggtctatca |
66 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
2132 |
gttttccactgagttttctgcagaggcacagatgcataggaggcctatca |
2083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University