View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12657_high_8 (Length: 296)
Name: NF12657_high_8
Description: NF12657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12657_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 39753188 - 39753347
Alignment:
| Q |
1 |
agcacagacttatgcaatatgaaaattcagttgtcttcttagggctactacatatttatatatgattcttacaagaatatttgattttggtaagacagat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753188 |
agcacatacttatgcaatatgaaaattcagttgtcttcttagggctgctacatatttatatatgattcttacaagaatatttgattttggtaagacagat |
39753287 |
T |
 |
| Q |
101 |
taaaaggtcaaacttttactatgattaacaccttatgaaaataacaaaattgaaggaata |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39753288 |
taaaaggtcaaacttttactatgattaacaccttatgaaaataataaaattgaaggaata |
39753347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University