View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12657_low_12 (Length: 296)

Name: NF12657_low_12
Description: NF12657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12657_low_12
NF12657_low_12
[»] chr3 (1 HSPs)
chr3 (1-160)||(39753188-39753347)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 39753188 - 39753347
Alignment:
1 agcacagacttatgcaatatgaaaattcagttgtcttcttagggctactacatatttatatatgattcttacaagaatatttgattttggtaagacagat 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
39753188 agcacatacttatgcaatatgaaaattcagttgtcttcttagggctgctacatatttatatatgattcttacaagaatatttgattttggtaagacagat 39753287  T
101 taaaaggtcaaacttttactatgattaacaccttatgaaaataacaaaattgaaggaata 160  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
39753288 taaaaggtcaaacttttactatgattaacaccttatgaaaataataaaattgaaggaata 39753347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University