View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_high_14 (Length: 309)
Name: NF12658_high_14
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 70993 - 71277
Alignment:
| Q |
18 |
gtgttcgcatgagaaattggggaaagtgggtgtccgaaatccgcgagccacgtaagaaatcgcggatttggctaggcactttccccaccgctgaaatggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
70993 |
gtgttcgcatgagaaattggggaaagtgggtgtccgaaatccgcgagccacgtaagaaatcgcggatttggctaggcactttccccactgctgaaatggc |
71092 |
T |
 |
| Q |
118 |
tgctagagcgcatgacgctgctgcgctatgcgttaaaggaaaatccgccattctaaatttccctcacttaagggattctcttccaaaacctgtttcttta |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
71093 |
tgctagagcgcatgacgctgctgcgctctgcgttaaaggaaaatccgccattctaaatttccctcacttaagagattctcttccaaaacctgtttcttta |
71192 |
T |
 |
| Q |
218 |
gcccctcgcgacgttcaggccgcggcggctaaagcagctcaaatggacattagcaaatttgagctatcatcaccttcttcttcat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
71193 |
gcccctcgcgacgttcaggccgcggcggctaaagcagctcaaatggacattggcaaatttgagctatcatcatcttcttcttcat |
71277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University