View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_high_19 (Length: 271)
Name: NF12658_high_19
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 37223842 - 37224085
Alignment:
| Q |
18 |
cctttgccatctggtgcatgtccctaatttctgaaaattggattgttgatttgaattccttttattgtatcctctccatgacatggagatcacatccatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
37223842 |
cctttgccatctggtgcatgtccctaatttctgaaaattggattgttgatttgaattcattttattgtatcctctccatggcatgtagatcacgtccatt |
37223941 |
T |
 |
| Q |
118 |
tttcattgttgtgttgttaacctgatctaattagaatcagattattgtttatgtttcagggcaatctttgttggtcttgcatacggatatgctacagttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223942 |
tttcattgttgtgttgttaacctgatctaattagaatcagattattgtttatgtttcagggcaacctttgttggtcttgcatacggatatgctacagttt |
37224041 |
T |
 |
| Q |
218 |
tatcctctagccttgcagttcccatggcttctcatgcagtgaac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37224042 |
tatcctctagccttgcagttcccatggcatctcatgcagtgaac |
37224085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University