View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_high_20 (Length: 251)
Name: NF12658_high_20
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 44770130 - 44769893
Alignment:
| Q |
2 |
tagctgttgcttttatatctaacacctactcatattctttcttgagttctcgatgtgggagaaaaaacatacgcaagaacttggttgggactcactggta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44770130 |
tagctgttgcttttatatctaacacctactcatattctttcttgagttctcgatgtgggacaaaaaacatacgcaagaacttggttgggactcactggta |
44770031 |
T |
|
| Q |
102 |
aaatccattgtacatttgtactcatgaccctttatatattcaaacaatatagttccaaagctacaaacattgccctgtatatatatgctgaagttgttta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44770030 |
aaatccattgtacatttgtactcatgaccctttatattttcaaacaatatagttccaaagctacaaacattgccctgtatatatatgctgaagttgttta |
44769931 |
T |
|
| Q |
202 |
ggcttcagaacttgtatcattgtagcaaccgcactttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44769930 |
ggcttcagaacttgtatcattgtagcaaccgcactttc |
44769893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 214
Target Start/End: Original strand, 49107090 - 49107146
Alignment:
| Q |
159 |
aagctacaaacattgccctgtatat-atatgctgaagttgtttaggcttcagaactt |
214 |
Q |
| |
|
||||||||||||||||||| | ||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
49107090 |
aagctacaaacattgccctttctatcatatcttgaagttgtttaggcttcacaactt |
49107146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University