View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12658_low_22 (Length: 271)

Name: NF12658_low_22
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12658_low_22
NF12658_low_22
[»] chr8 (1 HSPs)
chr8 (18-261)||(37223842-37224085)


Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 37223842 - 37224085
Alignment:
18 cctttgccatctggtgcatgtccctaatttctgaaaattggattgttgatttgaattccttttattgtatcctctccatgacatggagatcacatccatt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||| ||||||    
37223842 cctttgccatctggtgcatgtccctaatttctgaaaattggattgttgatttgaattcattttattgtatcctctccatggcatgtagatcacgtccatt 37223941  T
118 tttcattgttgtgttgttaacctgatctaattagaatcagattattgtttatgtttcagggcaatctttgttggtcttgcatacggatatgctacagttt 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37223942 tttcattgttgtgttgttaacctgatctaattagaatcagattattgtttatgtttcagggcaacctttgttggtcttgcatacggatatgctacagttt 37224041  T
218 tatcctctagccttgcagttcccatggcttctcatgcagtgaac 261  Q
    |||||||||||||||||||||||||||| |||||||||||||||    
37224042 tatcctctagccttgcagttcccatggcatctcatgcagtgaac 37224085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University