View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_25 (Length: 243)
Name: NF12658_low_25
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 197
Target Start/End: Original strand, 26305475 - 26305667
Alignment:
| Q |
12 |
aagcaaaggattcaggtaggtctcttcctctcacttcaccaagccatcttttaatatcttttcaagaaataaaaaagaaagtgtcattttagactcataa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
26305475 |
aagcaaaggattcaggtaggtctcttcctctcacttcaccaagccatcttttaatatcttttcaagaaataaaaaagaaagtgtcattttagagtcacaa |
26305574 |
T |
 |
| Q |
112 |
atcattgtcaca-------aattaataattaataatcatgaaacatttatgaataacaatgttgtcaattgcagattgtagacactaggagtt |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
26305575 |
atcattgtcacaaattaataattaataattaataatgatgaaacatttatgaataacaatgttgtcaattgcagatcatagacagtaggagtt |
26305667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 781240 - 781293
Alignment:
| Q |
12 |
aagcaaaggattcaggtaggtctcttcctctcacttcaccaagccatcttttaa |
65 |
Q |
| |
|
|||||||||||||||| | |||| ||||| ||| ||||||||||||||| |||| |
|
|
| T |
781240 |
aagcaaaggattcaggcaagtcttttcctttcaattcaccaagccatctcttaa |
781293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University