View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_26 (Length: 241)
Name: NF12658_low_26
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 226
Target Start/End: Complemental strand, 31296625 - 31296419
Alignment:
| Q |
24 |
cttagagagtttaatctc----gttaaactcaatcctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatata |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296625 |
cttagagagtttaatctcttccgttaaactcaaccctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatata |
31296526 |
T |
 |
| Q |
120 |
aattgtgctcttccaacattgtttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296525 |
aattgtgctcttccaacattgtttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgt |
31296426 |
T |
 |
| Q |
220 |
atatctt |
226 |
Q |
| |
|
||||||| |
|
|
| T |
31296425 |
atatctt |
31296419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University