View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_28 (Length: 238)
Name: NF12658_low_28
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 27 - 222
Target Start/End: Original strand, 44770231 - 44770426
Alignment:
| Q |
27 |
tgtagcatatgacctaatgataaaatcatccaaatgaataaattatttacatgccattaataaggttacnnnnnnntatatctcaagttggttttgaagt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44770231 |
tgtagcatatgacctaatgataaaatcatccaaatgaataaattatttacatgccattaataaggttacaaaaaaatatatctcaagttggttttgaaga |
44770330 |
T |
|
| Q |
127 |
ttttggcggatttttaaaccttatgagtgttaaccattgtatcacattattgnnnnnnnnacattcttagttataaaataaatacgaagaatgaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44770331 |
ttttggcggatttttaaaccttatgagtgttgaccattatatcacattattgttttttttacattcttagttataaaataaatacgaagaatgaac |
44770426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University