View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_29 (Length: 238)
Name: NF12658_low_29
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 35907177 - 35907382
Alignment:
| Q |
13 |
agcagagatagggagtgaggatcgtaattgaatgagttagatttgttacaagttggaagggaagaaacttatctatatttggcattcagtttccatagaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907177 |
agcagtgatagggagtgaggatcgtaattgaatgagttagatttgttacaagttggaagggaagaaacttatctatatttggcattcagtttccatagaa |
35907276 |
T |
|
| Q |
113 |
tttatgaaatgtgtttttgtttaatttacacattata-nnnnnnnnnatgacaaacaatttgctcacaatatatatatgaaaaatgctacatttcccaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907277 |
tttatgaaatgtgtttttgtttaatttacacattatatattttttttatgacaaacaatttgctcacaatatatatatgaaaaatgctacatttcccaaa |
35907376 |
T |
|
| Q |
212 |
aactat |
217 |
Q |
| |
|
|||||| |
|
|
| T |
35907377 |
aactat |
35907382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University