View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_37 (Length: 208)
Name: NF12658_low_37
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 8763262 - 8763084
Alignment:
| Q |
12 |
aagcaaaggagagaaagatattcaagttgttaagaaacaaaaacttgtttggacaccttatctccacaaaatgtttctgcttgctgttaaccaaattgga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8763262 |
aagccaaggagagaaagatattcaagttgttaagaaacaaaaacttgtttggacaccttatctccacaaaatgtttctgcttgctgttaaccaaattgga |
8763163 |
T |
|
| Q |
112 |
ttggaaagtaagtcatcttttaaaaatatttttcttatgaaaggctttttaattctaatcagttttacaatgtgttttt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
8763162 |
ttggaaagtaagtcatcttttaaaaatatttttcttatgaaaggctttttaaatctaattagttttacaatgtgttttt |
8763084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University