View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12658_low_38 (Length: 206)
Name: NF12658_low_38
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12658_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 44 - 193
Target Start/End: Complemental strand, 32567721 - 32567572
Alignment:
| Q |
44 |
acgtatctataaacaaatccaacatggaaagagaaataaattgagagaaagtcacagagttatgagctggtgcgcacgataaactctatgtgggaatgta |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32567721 |
acgtatctataaacaaatccaacatggaaagagaaataaattgagagaaagtcacagagttatgagctggtgcgcacgataaactctatgtgggaatgta |
32567622 |
T |
|
| Q |
144 |
atgtgactccactaaagccaaaggtggtgccactactacttgcctatgct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32567621 |
atgtgactccactaaagccaaaggtggtgccactactacttgcatatgct |
32567572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University