View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_high_19 (Length: 303)
Name: NF12659_high_19
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 878331 - 878622
Alignment:
| Q |
18 |
agaatggggccacacatgcaaaaagagcacatccaatatatcctataataatgaataacaatgatgagaaatgtgtccgaaatatcattcttggctgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
878331 |
agaatggggccacacatgcaaaaagagcacatccaaaatatcctataataatgaataacaatgatgagaaatgtgtccgaaatatcactcttggctgtct |
878430 |
T |
 |
| Q |
118 |
tgcaatttactcgttcgttaatttatgatcttttgagctatttgccaaaccatactatttgccaaaataatatgtacgaaagaaagcaccnnnnnnnnta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
878431 |
tgcaatttactcgttcgttaatttatgatcttttgagctatttgccaaaccatactatttgccaaaataatatgtacgaaagaaagcaccaaaaaaaata |
878530 |
T |
 |
| Q |
218 |
tcaatcaaagtaccattttgggtgacataaagtatg-----------aaaaaacaacccaatccaagtcttccaattgttacctatgcttct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
878531 |
tcaatcaaagtaccattttgggtgacataaagtatgaaattgttgaaaaaaaacaacccaatccaagtcttccaattgttacttaggcttct |
878622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University